pATP (pKD-T8)
(Plasmid
#62700)
-
PurposeMammalian expression of amiR-tyr with a tdTomato gene from the broadly active CAG promoter/enhancer
-
Depositing Lab
-
Depositing OrganizationTokai University
Located in Japan -
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62700 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC119
- Total vector size (bp) 7830
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameamiR-Tyr1001/amiR-Tyr1030/tdTomato
-
gRNA/shRNA sequenceTAAAGCTGAAATTGGCAGTTC/TGGACTGGCAAATCCTTCCAG
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pATP (pKD-T8) was a gift from Masato Ohtsuka (Addgene plasmid # 62700)
Map uploaded by the depositor.
Map uploaded by the depositor.
