-
PurposeExpressing mCherry from BLBP promoter which is a neural stem cell (radial glial cells) specific promoter
-
Depositing Lab
-
Depositing OrganizationVlaams Instituut voor Biotechnologie (VIB, vzw)
Located in Belgium -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 63721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 63721-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 63721-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAG-mCherry
- Backbone size w/o insert (bp) 1700
- Total vector size (bp) 5572
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBLBP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1700
-
Mutation1700 bp upstream of BLBP gene cloned in CAG-mCherry
-
Entrez GeneFabp7 (a.k.a. B-FABP, BFABP, Blbp, MRG)
- Promoter 1700bp upstream of BLBP gene
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer CAATGTCGACAGCACAGCAGAAAGGGAAAA
- 3′ sequencing primer GGTGGGCGCGCCAGGCAGGAACTGGAGGAACTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 63721-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 63721-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BLBP-mCherry was a gift from Bart De Strooper (Addgene plasmid # 63721 ; http://n2t.net/addgene:63721 ; RRID:Addgene_63721) -
For your References section:
APLP2 regulates neuronal stem cell differentiation during cortical development. Shariati SA, Lau P, Hassan BA, Muller U, Dotti CG, De Strooper B, Gartner A. J Cell Sci. 2013 Mar 1;126(Pt 5):1268-77. doi: 10.1242/jcs.122440. Epub 2013 Jan 23. 10.1242/jcs.122440 PubMed 23345401