Skip to main content

pGS1422
(Plasmid #63793)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63793 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pGS1412
  • Backbone size w/o insert (bp) 4940
  • Total vector size (bp) 5000
  • Vector type
    E. coli cloning vector
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eCitrine-Twin-tag followed by URA3 selection marker
  • Species
    Synthetic
  • Promoter none
  • Tag / Fusion Protein
    • eCitrine-Twin-tag (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTGGCTTAACTATGCGGCATCAG
  • 3′ sequencing primer gcaacctgacctacaggaaagag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Mark A. Sheff and Kurt S. Thorn (pKT175)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Derived from plasmid pGS1412 by site-directed mutagenesis. The Twin-Strep tag sequence is adapted from the sequence of commercial Twin-Strep tag plasmids offered by IBA, Goettingen, Germany.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGS1422 was a gift from Monika Golas & Bjoern Sander (Addgene plasmid # 63793 ; http://n2t.net/addgene:63793 ; RRID:Addgene_63793)
  • For your References section:

    Strep-tag II and Twin-Strep Based Cassettes for Protein Tagging by Homologous Recombination and Characterization of Endogenous Macromolecular Assemblies in Saccharomyces cerevisiae. Rai J, Pemmasani JK, Voronovsky A, Jensen IS, Manavalan A, Nyengaard JR, Golas MM, Sander B. Mol Biotechnol. 2014 Jun 27. 10.1007/s12033-014-9778-5 PubMed 24969434