Skip to main content

pLH-nmsgRNA1.1
(Plasmid #64115)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64115 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLKO.1
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 8313
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nm sgRNA1.1
  • gRNA/shRNA sequence
    gttgtagctccctttctcatttcggaaacgaaatgagaaccgttgctacaataaggccgtctgaaaagatgtgccgcaacgctctgccccttaaagcttctgctttaaggggcatcgttta
  • Species
    Synthetic
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SbfI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer cccttcaccgagggcctatttccc
  • 3′ sequencing primer CTATTCTTTCCCCTGCACTGTACCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLH-nmsgRNA1.1 was a gift from Thoru Pederson (Addgene plasmid # 64115 ; http://n2t.net/addgene:64115 ; RRID:Addgene_64115)
  • For your References section:

    Multicolor CRISPR labeling of chromosomal loci in human cells. Ma H, Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. 10.1073/pnas.1420024112 PubMed 25713381