-
PurposeVector for expression of Nm sgRNA1.1 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64115 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLKO.1
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 8313
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNm sgRNA1.1
-
gRNA/shRNA sequencegttgtagctccctttctcatttcggaaacgaaatgagaaccgttgctacaataaggccgtctgaaaagatgtgccgcaacgctctgccccttaaagcttctgctttaaggggcatcgttta
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer cccttcaccgagggcctatttccc
- 3′ sequencing primer CTATTCTTTCCCCTGCACTGTACCC
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLH-nmsgRNA1.1 was a gift from Thoru Pederson (Addgene plasmid # 64115 ; http://n2t.net/addgene:64115 ; RRID:Addgene_64115) -
For your References section:
Multicolor CRISPR labeling of chromosomal loci in human cells. Ma H, Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. 10.1073/pnas.1420024112 PubMed 25713381