Skip to main content

pMSCV-PIG-miR-34a
(Plasmid #64233)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64233 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    MSCV PIG
  • Backbone manufacturer
    Scott Lowe
  • Backbone size w/o insert (bp) 7658
  • Total vector size (bp) 8036
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR34a
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    373
  • GenBank ID
    NR_029610
  • Entrez Gene
    MIR34A (a.k.a. MIRN34A, miRNA34A, mir-34, mir-34a)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GATGTGGAATGTGTGCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-PIG-miR-34a was a gift from Joshua Mendell (Addgene plasmid # 64233)
  • For your References section:

    Widespread microRNA repression by Myc contributes to tumorigenesis. Chang TC, Yu D, Lee YS, Wentzel EA, Arking DE, West KM, Dang CV, Thomas-Tikhonenko A, Mendell JT. Nat Genet. 2008 Jan;40(1):43-50. Epub 2007 Dec 9. 10.1038/ng.2007.30 PubMed 18066065