Skip to main content

pGFP
(Plasmid #64904)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64904 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 64904-D50 50 μg of DNA in Tris buffer $495
DNA 64904-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    psbA
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 8726
  • Vector type
    psbA Chlamydomonas reinhardtii vector
  • Selectable markers
    kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Green fluorescent protein
  • Alt name
    GFP
  • Species
    Aequorea victoria
  • Insert Size (bp)
    726
  • Promoter psbA

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gtgctaggtaactaacgtttgattttt
  • 3′ sequencing primer cGGATCCTACGTAGGCGCCGAATTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFP was a gift from Stephen Mayfield (Addgene plasmid # 64904 ; http://n2t.net/addgene:64904 ; RRID:Addgene_64904)
  • For your References section:

    Selenocystamine improves protein accumulation in chloroplasts of eukaryotic green algae. Ferreira-Camargo LS, Tran M, Beld J, Burkart MD, Mayfield SP. AMB Express. 2015 Dec;5(1):126. doi: 10.1186/s13568-015-0126-3. Epub 2015 Jul 3. 10.1186/s13568-015-0126-3 PubMed 26137911