pBa-MARK2-eGFP
(Plasmid #66706)

• Purpose: mammalian expression vector for MARK2 with a C-terminal eGFP
• Depositing Labs: Gary Banker, Marvin Bentley
• Depositing Organization: Oregon Health & Science University
  Located in United States of America
• Publication: Banker Lab MARK2-GFP (unpublished)
• Citations: 3 Articles

Backbone

• Vector backbone: pBa-eGFP
• Backbone size w/o insert (bp): 6732
• Total vector size (bp): 8967
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MARK2
• Alt name: microtubule affinity-regulating kinase 2
• Alt name: MAP/microtubule affinity-regulating kinase 2
• Alt name: Serine/threonine-protein kinase MARK2
• Species: H. sapiens (human)
• Insert Size (bp): 2235
• GenBank ID: NM_004954 NP_004945.4
• Entrez Gene: MARK2 (a.k.a. EMK-1, EMK1, PAR-1, Par-1b, Par1b)
• Promoter: chicken beta actin
• Tag / Fusion Protein:
  • eGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BlnI-blunted on vector, PsiI on insert (destroyed during cloning)
• 3′ cloning site: BlnI-blunted on vector, PsiI on insert (destroyed during cloning)
• 5′ sequencing primer: TTCGGCTTCTGGCGTGTGAC
• 3′ sequencing primer: AGCTTGCCGGTGGTGCAGAT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: From Addgene (Plasmid #23404 from William Hahn) which contained 2bp deletion causing a frame shift. This was repaired by PCR and Restriction sites: 5' ClaI and 3' Bsu36I. Both sites remain. Sequence of primer to verify repair 5'-AACCTCAAGGAGCTGCGGGAAC-3'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.

DNA (Catalog # 66706-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 66706-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.