Skip to main content

pcDNA5FRT-EF-Pdgfrbeta-EGFPN
(Plasmid #66790)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66790 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 66790-D50 50 μg of DNA in Tris buffer $495
DNA 66790-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA5FRT
  • Total vector size (bp) 9654
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PDGFRbeta
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4079
  • GenBank ID
    AAH55311.1
  • Entrez Gene
    Pdgfrb (a.k.a. CD140b, PDGFR-1, Pdgfr)
  • Promoter EF1a
  • Tag / Fusion Protein
    • C-term EGFP

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer EF-1a-F (TCAAGCCTCAGACAGTGGTTC)
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5FRT-EF-Pdgfrbeta-EGFPN was a gift from Lotte Pedersen (Addgene plasmid # 66790 ; http://n2t.net/addgene:66790 ; RRID:Addgene_66790)
  • For your References section:

    PDGFRbeta and oncogenic mutant PDGFRalpha D842V promote disassembly of primary cilia through a PLCgamma- and AURKA-dependent mechanism. Nielsen BS, Malinda RR, Schmid FM, Pedersen SF, Christensen ST, Pedersen LB. J Cell Sci. 2015 Oct 1;128(19):3543-9. doi: 10.1242/jcs.173559. Epub 2015 Aug 19. 10.1242/jcs.173559 PubMed 26290382