-
PurposeExpression of human EKLF driven by SV40 promoter for use in activation studies
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67835 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSG5
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4076
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEKLF
-
SpeciesH. sapiens (human)
-
Entrez GeneKLF1 (a.k.a. EKLF, EKLF/KLF1)
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer SV40pro-F2 (CCCCATGGCTGACTAATTTTT)
- 3′ sequencing primer SV40 poly A Reverse
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Full-length human EKLF cDNA was generated from bone marrow total RNA. This was used for activation studies.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG5-hEKLF was a gift from James Bieker (Addgene plasmid # 67835 ; http://n2t.net/addgene:67835 ; RRID:Addgene_67835) -
For your References section:
Structural and functional characterization of an atypical activation domain in erythroid Kruppel-like factor (EKLF). Mas C, Lussier-Price M, Soni S, Morse T, Arseneault G, Di Lello P, Lafrance-Vanasse J, Bieker JJ, Omichinski JG. Proc Natl Acad Sci U S A. 2011 Jun 28;108(26):10484-9. doi: 10.1073/pnas.1017029108. Epub 2011 Jun 13. 10.1073/pnas.1017029108 PubMed 21670263