Skip to main content
Addgene
Open Menu

pCMV-TNT-CFP-STIM1-C227W
(Plasmid #68403)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68403 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 68403-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 68403-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCMVTnT™ Vector
  • Backbone size w/o insert (bp) 4050
  • Total vector size (bp) 4400
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CFP-STIM1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2781
  • Mutation
    Changed Cysteine 227 to Tryptophan; CFP was inserted into STIM between G37 and A38.
  • Entrez Gene
    STIM1 (a.k.a. D11S4896E, GOK, IMD10, STRMK, TAM, TAM1)
  • Promoter CMV
  • Tag / Fusion Protein
    • Cyan Fluorescent Protein (CFP)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcorI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer ccg GAATTC ATGGATGTATGCGTC CGTCTTG
  • 3′ sequencing primer cgg GCGGCCGC CTACTTCTTAAGAGGCTTCTTAAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-TNT-CFP-STIM1-C227W was a gift from Yubin Zhou (Addgene plasmid # 68403 ; http://n2t.net/addgene:68403 ; RRID:Addgene_68403)

  • For your References section:

    Inside-out Ca(2+) signalling prompted by STIM1 conformational switch. Ma G, Wei M, He L, Liu C, Wu B, Zhang SL, Jing J, Liang X, Senes A, Tan P, Li S, Sun A, Bi Y, Zhong L, Si H, Shen Y, Li M, Lee MS, Zhou W, Wang J, Wang Y, Zhou Y. Nat Commun. 2015 Jul 17;6:7826. doi: 10.1038/ncomms8826. 10.1038/ncomms8826 PubMed 26184105
Related items:
Commonly requested with: