pJBL2184
(Plasmid
#71209)
-
PurposepbuE Sense Expression Plasmid
-
Depositing Lab
-
Depositing OrganizationCornell University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71209 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneCustom
-
Backbone manufacturerN/A
- Total vector size (bp) 3405
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namepbuE Sense
- Promoter BBa_J23119
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer aaatgtagcacctgaagtcagcccc
- 3′ sequencing primer ctcaatgatgatgatgatgatggtc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJBL2184 was a gift from Julius Lucks (Addgene plasmid # 71209 ; http://n2t.net/addgene:71209 ; RRID:Addgene_71209) -
For your References section:
Creating small transcription activating RNAs. Chappell J, Takahashi MK, Lucks JB. Nat Chem Biol. 2015 Mar;11(3):214-20. doi: 10.1038/nchembio.1737. Epub 2015 Feb 2. 10.1038/nchembio.1737 PubMed 25643173