sgGLDC_1
(Plasmid
#72886)
-
PurposeCRISPR-Cas9 induced gene disruption
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72886 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLentiCRISPR version 1
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgGLDC
-
gRNA/shRNA sequenceCGGGACAGCAGCAGTGGCGG (minus strand)
-
SpeciesH. sapiens (human)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bsmb1 (unknown if destroyed)
- 3′ cloning site Bsmb1 (unknown if destroyed)
- 5′ sequencing primer pLKO-F ATG TCG TAA CAA CTC CGC CCC ATT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgGLDC_1 was a gift from David Sabatini (Addgene plasmid # 72886 ; http://n2t.net/addgene:72886 ; RRID:Addgene_72886) -
For your References section:
SHMT2 drives glioma cell survival in ischaemia but imposes a dependence on glycine clearance. Kim D, Fiske BP, Birsoy K, Freinkman E, Kami K, Possemato RL, Chudnovsky Y, Pacold ME, Chen WW, Cantor JR, Shelton LM, Gui DY, Kwon M, Ramkissoon SH, Ligon KL, Kang SW, Snuderl M, Vander Heiden MG, Sabatini DM. Nature. 2015 Apr 16;520(7547):363-7. doi: 10.1038/nature14363. Epub 2015 Apr 8. 10.1038/nature14363 PubMed 25855294