Ac 1.8kb red opsin GFP.
(Plasmid
#72915)
-
Purposered opsin promoter from Carolina anole lizard (Anolis carolinensis) gDNA (nucleotides21,797 to 187, corresponding to chr2:88663108–88664997 in anoCar2.0) driving GFP
-
Depositing Lab
-
Depositing OrganizationWashington University in Saint Louis
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72915 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAGGS
-
Modifications to backboneno basal GFP Hsiau TH, Diaconu C, Myers CA, Lee J, Cepko CL, Corbo JC.2007. The cis-regulatory logic of the mammalian photore-ceptor transcriptional network. PloS One 2:e643.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namered opsin promoter
-
SpeciesAnolis carolinensis
-
Insert Size (bp)1884
-
GenBank IDU08131
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTGGCTTGAAAGAGGACTCG
- 3′ sequencing primer GCTATCCCTTGTGGTGTCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ac 1.8kb red opsin GFP. was a gift from Joseph Corbo (Addgene plasmid # 72915 ; http://n2t.net/addgene:72915 ; RRID:Addgene_72915) -
For your References section:
Transcriptome profiling of developing photoreceptor subtypes reveals candidate genes involved in avian photoreceptor diversification. Enright JM, Lawrence KA, Hadzic T, Corbo JC. J Comp Neurol. 2015 Mar 1;523(4):649-68. doi: 10.1002/cne.23702. Epub 2014 Dec 1. 10.1002/cne.23702 PubMed 25349106