Tg 2 kb Violet opsin DsRed
(Plasmid
#72920)
-
Purposeviolet opsin promoter from zebra finch (Taeniopygia guttata) gDNA (nucleotides21,946 to 145, corresponding to chr1A_ran-dom:206453–208444 in taeGut1) driving DsRed
-
Depositing Lab
-
Depositing OrganizationWashington University in Saint Louis
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72920 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAGGS
-
Modifications to backboneno basal Dsred Hsiau TH, Diaconu C, Myers CA, Lee J, Cepko CL, Corbo JC.2007. The cis-regulatory logic of the mammalian photore-ceptor transcriptional network. PloS One 2:e643.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameviolet opsin promoter
-
Specieszebra finch (Taeniopygia guttata)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnII (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer GGCAGAGGAAGATGATGGTG
- 3′ sequencing primer CTCACCGACGACTGGTTCTTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tg 2 kb Violet opsin DsRed was a gift from Joseph Corbo (Addgene plasmid # 72920 ; http://n2t.net/addgene:72920 ; RRID:Addgene_72920) -
For your References section:
Transcriptome profiling of developing photoreceptor subtypes reveals candidate genes involved in avian photoreceptor diversification. Enright JM, Lawrence KA, Hadzic T, Corbo JC. J Comp Neurol. 2015 Mar 1;523(4):649-68. doi: 10.1002/cne.23702. Epub 2014 Dec 1. 10.1002/cne.23702 PubMed 25349106