Skip to main content

mg409
(Plasmid #73368)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73368 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 73368-D50 50 μg of DNA in Tris buffer $495
DNA 73368-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TSMod::unc-70
  • Species
    C. elegans (nematode)
  • Entrez Gene
    unc-70 (a.k.a. CELE_K11C4.3)
  • Promoter unc-70p

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site sal1 (unknown if destroyed)
  • 3′ cloning site sal1 (unknown if destroyed)
  • 5′ sequencing primer TCACACAGGAAACAGCTATGA
  • 3′ sequencing primer CTGGCCGTCGTTTTACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mg409 was a gift from Miriam Goodman (Addgene plasmid # 73368 ; http://n2t.net/addgene:73368 ; RRID:Addgene_73368)
  • For your References section:

    Mechanical control of the sense of touch by beta-spectrin. Krieg M, Dunn AR, Goodman MB. Nat Cell Biol. 2014 Mar;16(3):224-33. doi: 10.1038/ncb2915. Epub 2014 Feb 23. 10.1038/ncb2915 PubMed 24561618