mg409
(Plasmid
#73368)
-
Purposeunc-70 no-force control
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73368 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 73368-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 73368-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTSMod::unc-70
-
SpeciesC. elegans (nematode)
-
Entrez Geneunc-70 (a.k.a. CELE_K11C4.3)
- Promoter unc-70p
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site sal1 (unknown if destroyed)
- 3′ cloning site sal1 (unknown if destroyed)
- 5′ sequencing primer TCACACAGGAAACAGCTATGA
- 3′ sequencing primer CTGGCCGTCGTTTTACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 73368-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 73368-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mg409 was a gift from Miriam Goodman (Addgene plasmid # 73368 ; http://n2t.net/addgene:73368 ; RRID:Addgene_73368) -
For your References section:
Mechanical control of the sense of touch by beta-spectrin. Krieg M, Dunn AR, Goodman MB. Nat Cell Biol. 2014 Mar;16(3):224-33. doi: 10.1038/ncb2915. Epub 2014 Feb 23. 10.1038/ncb2915 PubMed 24561618