Skip to main content
Addgene
Open Menu

pcDNA 3.2/V5-DEST SNAP29-V5
(Plasmid #73599)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73599 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pcDNA 3.2/V5-DEST
  • Backbone size w/o insert (bp) 5496
  • Total vector size (bp) 9310
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Synaptosomal-associated protein 29
  • Alt name
    SNAP29
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    774
  • Promoter CMV
  • Tag / Fusion Protein
    • V5 (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GGCACCAAAATCAACGGGACTTTC
  • 3′ sequencing primer GTCTCCTTCCGTGTTTCAGTTAGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

cDNA is from Orfeome library (Open Biosystems)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA 3.2/V5-DEST SNAP29-V5 was a gift from Anne Brunet (Addgene plasmid # 73599)
Related items: