pccGFPKAN
(Plasmid
#73649)
-
Purpose(Empty Backbone) Fluorescent reporter for transmembrane protein dimerization.
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73649 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepccKAN
- Backbone size (bp) 9103
-
Modifications to backboneReplacement of CAT gene with sfGFP gene
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer catgactttgtttggcgagagcaag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pccGFPKAN was a gift from Alessandro Senes (Addgene plasmid # 73649 ; http://n2t.net/addgene:73649 ; RRID:Addgene_73649) -
For your References section:
Screening for transmembrane association in divisome proteins using TOXGREEN, a high-throughput variant of the TOXCAT assay. Armstrong CR, Senes A. Biochim Biophys Acta. 2016 Jul 21. pii: S0005-2736(16)30251-6. doi: 10.1016/j.bbamem.2016.07.008. 10.1016/j.bbamem.2016.07.008 PubMed 27453198