CpcB-Solanum-lycopersicumPHLS_CpcA
(Plasmid
#74003)
-
PurposeExpresses the Solanum lycopersicum PHLS as a fusion with the CpcB protein plus the NPPS and CmR cassete in Synechocystis
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Berkeley
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74003 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 74003-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 74003-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBluescript KS+
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 2877
- Total vector size (bp) 8384
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePHLS and CmR
-
Alt nameSolanum lycopersicum phellandrene synthase (PHLS) fused to CpcB plus NPPS andCmR
-
SpeciesSynechocystis and Solanum lycopersicum
-
Insert Size (bp)4213
-
GenBank IDACO56896.1 AGF50922.1
- Promoter cpc
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer aagagtccctgaatatcaaa
- 3′ sequencing primer AGATCTCTAGTGGTTTAACG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNeryl diphosphate synthase from Solanum lycopersicum
-
Alt nameNPPS
-
Insert Size (bp)784
-
GenBank IDACO56895.1
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TCACATTCTAACGGGAGATA
- 3′ sequencing primer ctagctcagagcattgatgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 74003-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 74003-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CpcB-Solanum-lycopersicumPHLS_CpcA was a gift from Anastasios Melis (Addgene plasmid # 74003 ; http://n2t.net/addgene:74003 ; RRID:Addgene_74003) -
For your References section:
Cyanobacterial production of plant essential oils. Formighieri C, Melis A. Planta. 2018 Oct;248(4):933-946. doi: 10.1007/s00425-018-2948-0. Epub 2018 Jul 4. 10.1007/s00425-018-2948-0 PubMed 29974209