Skip to main content
Addgene
Open Menu

pLX_TRC311 ETV4-L
(Plasmid #74982)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74982 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 74982-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 74982-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pLX_TRC311
  • Backbone manufacturer
    Broad Institute - Genetic Perturbation Platform
  • Backbone size w/o insert (bp) 10065
  • Total vector size (bp) 9882
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ETV4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1455
  • Mutation
    S396N
  • GenBank ID
    NM_001079675
  • Entrez Gene
    ETV4 (a.k.a. E1A-F, E1AF, PEA3, PEAS3)
  • Promoter EF1a

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer WPRE-R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX_TRC311 ETV4-L was a gift from William Hahn (Addgene plasmid # 74982 ; http://n2t.net/addgene:74982 ; RRID:Addgene_74982)

  • For your References section:

    ATXN1L, CIC, and ETS Transcription Factors Modulate Sensitivity to MAPK Pathway Inhibition. Wang B, Krall EB, Aguirre AJ, Kim M, Widlund HR, Doshi MB, Sicinska E, Sulahian R, Goodale A, Cowley GS, Piccioni F, Doench JG, Root DE, Hahn WC. Cell Rep. 2017 Feb 7;18(6):1543-1557. doi: 10.1016/j.celrep.2017.01.031. 10.1016/j.celrep.2017.01.031 PubMed 28178529
Related items:
Commonly requested with: