Skip to main content

Puro-iNgn3
(Plasmid #75337)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 75337 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 75337-D50 50 μg of DNA in Tris buffer $495
DNA 75337-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    N/A
  • Total vector size (bp) 7954
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    neurogenin 3
  • Alt name
    Ngn3
  • Alt name
    Neurog3
  • Species
    M. musculus (mouse)
  • GenBank ID
    50674
  • Entrez Gene
    Neurog3 (a.k.a. Atoh5, Math4B, bHLHa7, ngn3)
  • Promoter TRE-tight

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cagctcaggttctgggagag
  • 3′ sequencing primer gaaatttgtgatgctattgc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Puro-iNgn3 was a gift from Danwei Huangfu (Addgene plasmid # 75337 ; http://n2t.net/addgene:75337 ; RRID:Addgene_75337)
  • For your References section:

    Genome Editing of Lineage Determinants in Human Pluripotent Stem Cells Reveals Mechanisms of Pancreatic Development and Diabetes. Zhu Z, Li QV, Lee K, Rosen BP, Gonzalez F, Soh CL, Huangfu D. Cell Stem Cell. 2016 Apr 27. pii: S1934-5909(16)30002-9. doi: 10.1016/j.stem.2016.03.015. 10.1016/j.stem.2016.03.015 PubMed 27133796