-
PurposepsiCHECK2 dual luciferase reporter harboring a fully complementary let-7 target element, cloned into the XhoI/NotI restriction sites, the 3'UTR of the Renilla Luciferase gene
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Los Angeles (UCLA)
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78260 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 78260-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 78260-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepsiCHECK-2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6273
- Total vector size (bp) 6302
-
Vector typeMammalian Expression, Luciferase ; microRNA activity
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefully complimentary let-7 target site
-
SpeciesSynthetic
-
Insert Size (bp)29
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGTGCTGAAGAACGAGCAGT
- 3′ sequencing primer CAAACCCCCGCCTCCACGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 78260-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 78260-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCHECK2-let-7 WT was a gift from Joanne Weidhaas (Addgene plasmid # 78260 ; http://n2t.net/addgene:78260 ; RRID:Addgene_78260) -
For your References section:
miR-34 activity is modulated through 5'-end phosphorylation in response to DNA damage. Salzman DW, Nakamura K, Nallur S, Dookwah MT, Metheetrairut C, Slack FJ, Weidhaas JB. Nat Commun. 2016 Mar 21;7:10954. doi: 10.1038/ncomms10954. 10.1038/ncomms10954 PubMed 26996824