hMYOG-3xHA-IRES-hrGFP (#324)
(Plasmid
#78341)
-
PurposeOverexpression of human MYOG ORF with a 3xHA C-terminal tag and an IRES-hrGFP reporter
-
Depositing Labs
-
Depositing OrganizationBoston Children's Hospital
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78341 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 78341-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 78341-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepIRES-2a-hrGFP
-
Backbone manufacturerAgilent Technologies
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 5750
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMYOG
-
Alt namemyogenin
-
Alt namemyogenic factor 4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)672
-
GenBank IDNM_002479.5
-
Entrez GeneMYOG (a.k.a. MYF4, bHLHc3, myf-4)
- Promoter CMV
-
Tags
/ Fusion Proteins
- 3x HA tag (C terminal on backbone)
- IRES-hrGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer CAAGGATGACGACGATAAG
- 3′ sequencing primer CTATTAAGCGTAGTCAGGTACATC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains a 2 amino acid deletion. Does not affect function. Please contact Dr. Alexander if you have any questions.
DNA (Catalog # 78341-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 78341-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hMYOG-3xHA-IRES-hrGFP (#324) was a gift from Matthew Alexander & Louis Kunkel (Addgene plasmid # 78341 ; http://n2t.net/addgene:78341 ; RRID:Addgene_78341)
Map uploaded by the depositor.