-
PurposePlasmid expressing UirR, response regulator and PcsiR1-regulated GFP output
-
Depositing Lab
-
Depositing OrganizationRice University
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonecolE1
- Total vector size (bp) 3964
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameuirR
-
Insert Size (bp)726
- Promoter J23115
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GACGTCTAAGAAACCATTATTATCATGAC
- 3′ sequencing primer GTATTACCGCCTTTGAGTGAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPR219.05 was a gift from Jeffrey Tabor (Addgene plasmid # 78554 ; http://n2t.net/addgene:78554 ; RRID:Addgene_78554) -
For your References section:
Repurposing Synechocystis PCC6803 UirS-UirR as a UV-violet/green photoreversible transcriptional regulatory tool in E. coli. Ramakrishnan P, Tabor JJ. ACS Synth Biol. 2016 Apr 27. 10.1021/acssynbio.6b00068 PubMed 27120220