pRK-flag-USP19 C506S
(Plasmid
#78584)
-
PurposeExpression flag-USP19 C506S in mammalian cells
-
Depositing Lab
-
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78584 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRK
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 11000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameflag-USP19 C506S
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3954
-
Mutationmutate 506 cysteine residue to serine
-
GenBank IDNM_006677.2
-
Entrez GeneUSP19 (a.k.a. ZMYND9)
- Promoter CMV
-
Tag
/ Fusion Protein
- flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CCTACTCAGACAATGCGATGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Ye PCR amplified USP19 cDNA from a plasmid obtained from Simon Wing’s lab in Canada and then cloned them into the pRK FLAG vector we have in the lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK-flag-USP19 C506S was a gift from Yihong Ye (Addgene plasmid # 78584 ; http://n2t.net/addgene:78584 ; RRID:Addgene_78584) -
For your References section:
Unconventional secretion of misfolded proteins promotes adaptation to proteasome dysfunction in mammalian cells. Lee JG, Takahama S, Zhang G, Tomarev SI, Ye Y. Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13. 10.1038/ncb3372 PubMed 27295555