Skip to main content

CSII-IDR2-chimpTRIM5-FOS
(Plasmid #79065)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79065 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 79065-D50 50 μg of DNA in Tris buffer $495
DNA 79065-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    CSII-BBN-IRES-DsRed
  • Backbone manufacturer
    CSII-BBN-IDR2
  • Backbone size w/o insert (bp) 9866
  • Total vector size (bp) 11411
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TRIM5alpha(chimpanzee)-FOS
  • Alt name
    TRIM5alpha(CPZ)-FOS
  • Species
    Pan troglodytes
  • Insert Size (bp)
    1479
  • GenBank ID
    AAW72445.1
  • Promoter CMV
  • Tag / Fusion Protein
    • OneSTrEP-FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer CAGAGCTGGTTTAGTGAACC
  • 3′ sequencing primer GCCAAAAGACGGCAATATGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CMV promoter and IRES DsRed co expression

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CSII-IDR2-chimpTRIM5-FOS was a gift from Wesley Sundquist (Addgene plasmid # 79065 ; http://n2t.net/addgene:79065 ; RRID:Addgene_79065)
  • For your References section:

    Primate TRIM5 proteins form hexagonal nets on HIV-1 capsids. Li YL, Chandrasekaran V, Carter SD, Woodward CL, Christensen DE, Dryden KA, Pornillos O, Yeager M, Ganser-Pornillos BK, Jensen GJ, Sundquist WI. Elife. 2016 Jun 2;5. pii: e16269. doi: 10.7554/eLife.16269. 10.7554/eLife.16269 PubMed 27253068