pcDNA4/TO/FLAG-hPMR1(2H)-Tev-Bio
(Plasmid
#80325)
-
PurposeExpresses a catalytically inactive form of human PMR1 endonuclease with N-terminal FLAG and C-terminal biotinylation tags
-
Depositing Lab
-
Depositing OrganizationOhio State University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80325 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA4/TO
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 4987
- Total vector size (bp) 6897
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePXDNL-003
-
Alt namehPMR1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1910
-
MutationH170A and H256A
-
GenBank IDBC132813
-
Entrez GenePXDNL (a.k.a. PMR1, PRM1, VPO2)
- Promoter CMV
-
Tag
/ Fusion Protein
- Biotin (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site ApaI (unknown if destroyed)
- 5′ sequencing primer cggcgtgccgggtgttcatgggg
- 3′ sequencing primer ggcgtccctgagccgggtgctttgtg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
hPMR1 corresponds to Ensembl transcript PXDNL-003. In this form of the protein the 2 histidine residues that correspond to the active site have been changed to alanine to generate a catalytically inactive protein.
Please note that the hPMR1 insert in this plasmid is numbered starting with the first methionine in GenBank reference sequence BC132813. This plasmid does not encode the 1463 aa PXDNL protein in GenBank NM_144651.4
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA4/TO/FLAG-hPMR1(2H)-Tev-Bio was a gift from Daniel Schoenberg (Addgene plasmid # 80325 ; http://n2t.net/addgene:80325 ; RRID:Addgene_80325) -
For your References section:
Identification of the human PMR1 mRNA endonuclease as an alternatively processed product of the gene for peroxidasin-like protein. Gu SQ, Bakthavachalu B, Han J, Patil DP, Otsuka Y, Guda C, Schoenberg DR. RNA. 2012 Jun;18(6):1186-96. doi: 10.1261/rna.031369.111. Epub 2012 Apr 27. 10.1261/rna.031369.111 PubMed 22543864