pGrDL_SPb
(Plasmid
#83205)
-
Purposereceives miRNA target sequences for testing using the dual luciferase assay system
-
Depositing Lab
-
Depositing OrganizationUniversity of Queensland
Located in Australia -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83205 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGrDL_SP
-
Backbone manufacturerRichard Moyle
- Backbone size w/o insert (bp) 7086
- Total vector size (bp) 7769
-
Modifications to backbonereplaced NOS promoter with a tomato ACTIN promoter to drive expression of the Renilla luciferase
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTomato ACTIN promoter
-
SpeciesTomato
-
Insert Size (bp)1007
- Promoter Tomato ACTIN
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site FSPI (unknown if destroyed)
- 3′ cloning site PSPXI (destroyed during cloning)
- 5′ sequencing primer ccactgcggaccagttatcatcc
- 3′ sequencing primer cgccagctggcgtaatagc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGrDL_SPb was a gift from Peer Schenk (Addgene plasmid # 83205 ; http://n2t.net/addgene:83205 ; RRID:Addgene_83205) -
For your References section:
An Optimized Transient Dual Luciferase Assay for Quantifying MicroRNA Directed Repression of Targeted Sequences. Moyle RL, Carvalhais LC, Pretorius LS, Nowak E, Subramaniam G, Dalton-Morgan J, Schenk PM. Front Plant Sci. 2017 Sep 20;8:1631. doi: 10.3389/fpls.2017.01631. eCollection 2017. 10.3389/fpls.2017.01631 PubMed 28979287