pLMB687
(Plasmid
#83781)
-
PurposeSucrose biosensor plasmid
-
Depositing Lab
-
Depositing OrganizationUniversity of Oxford
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83781 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 83781-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 83781-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepIJ11268
-
Backbone manufacturer16260
- Backbone size w/o insert (bp) 17558
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)E. coli S17-1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRegion upstream pRL120556 containing all of pRL120555
-
SpeciesRhizobium leguminosarum bv. viciae, strain 3841
-
Insert Size (bp)1230
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CCATCTTTGCCCTACCGTAT
- 3′ sequencing primer AAACCGACGCCATCACCCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 83781-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 83781-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLMB687 was a gift from Philip Poole (Addgene plasmid # 83781 ; http://n2t.net/addgene:83781 ; RRID:Addgene_83781) -
For your References section:
Bacterial Biosensors for in Vivo Spatiotemporal Mapping of Root Secretion. Pini F, East AK, Appia-Ayme C, Tomek J, Karunakaran R, Mendoza-Suarez M, Edwards A, Terpolilli JJ, Roworth J, Downie JA, Poole PS. Plant Physiol. 2017 Jul;174(3):1289-1306. doi: 10.1104/pp.16.01302. Epub 2017 May 11. 10.1104/pp.16.01302 PubMed 28495892