pBS5
(Plasmid
#83799)
-
PurposeUseful for tagging yeast proteins with N-terminal CFP tag; G418 selection
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83799 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepyGFP
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCFP
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TEF-terminator-F, CCCAGATGCGAAGTTAAGTG
- 3′ sequencing primer T7
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information, see http://yeastrc.org/yeastrc/pages/plasmids_protocols.html
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS5 was a gift from Eric Muller (Addgene plasmid # 83799 ; http://n2t.net/addgene:83799 ; RRID:Addgene_83799) -
For your References section:
Fluorescence resonance energy transfer using color variants of green fluorescent protein. Hailey DW, Davis TN, Muller EG. Methods Enzymol. 2002;351:34-49. PubMed 12073355