pPJ167(JPUB_006765)
(Plasmid
#83831)
-
PurposeCarries NEW operon 3 final
-
Depositing Lab
-
Depositing OrganizationLawrence Berkeley National Laboratory
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83831 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 83831-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 83831-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBbE0k backbone (colE1 ori, kanR)
- Total vector size (bp) 712
-
Selectable markersKan
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMedium copy strain
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameKuste2803
-
Alt nameSAM radical enzyme
-
Insert Size (bp)1482
- Promoter op3_BsmBI_2803_for
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer aattccgaattcatgagatctggatccgtctcaatgaagaaactggttctgatcaacc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameKuste2804
-
Alt nameFabF
-
Insert Size (bp)1218
- Promoter op3_2804_for
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cataaaggaggttttctaatgaaaatgaccaaagttgtgattacc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 83831-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 83831-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPJ167(JPUB_006765) was a gift from Harry Beller (Addgene plasmid # 83831 ; http://n2t.net/addgene:83831 ; RRID:Addgene_83831) -
For your References section:
Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli. Javidpour P, Deutsch S, Mutalik VK, Hillson NJ, Petzold CJ, Keasling JD, Beller HR. PLoS One. 2016 Mar 14;11(3):e0151087. doi: 10.1371/journal.pone.0151087. eCollection 2016. PONE-D-16-02052 [pii] PubMed 26975050
Map uploaded by the depositor.
