pPJ170(JPUB_006771)
(Plasmid
#83833)
-
PurposeCarries NEW operon 6 final
-
Depositing Lab
-
Depositing OrganizationLawrence Berkeley National Laboratory
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83833 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBbE0k backbone (colE1 ori, kanR)
-
Selectable markersKan
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMedium Copy
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameKuste3346
-
Alt nameFabF
-
Insert Size (bp)1182
- Promoter op6_BsmBI_3346_for
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer catgagatctggatccgtctcaatgagtggccgcatcctg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameKuste3348
-
Alt namenon-canonical FabF
-
Insert Size (bp)1062
- Promoter op6_3348_for
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer aattccgaattcatgagatctggatcatggatcgtattgtgctgacc
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameKuste3349
-
Alt nameFabF
-
Insert Size (bp)1215
- Promoter op6_3349_for
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer gttaaaggaggttttctaatgaaaaaacgtgttgtgattaccg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPJ170(JPUB_006771) was a gift from Harry Beller (Addgene plasmid # 83833 ; http://n2t.net/addgene:83833 ; RRID:Addgene_83833) -
For your References section:
Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli. Javidpour P, Deutsch S, Mutalik VK, Hillson NJ, Petzold CJ, Keasling JD, Beller HR. PLoS One. 2016 Mar 14;11(3):e0151087. doi: 10.1371/journal.pone.0151087. eCollection 2016. PONE-D-16-02052 [pii] PubMed 26975050