pPJ169(JPUB_006769)
(Plasmid
#83835)
-
PurposeCarries NEW operon 5 final
-
Depositing Lab
-
Depositing OrganizationLawrence Berkeley National Laboratory
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83835 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBbE0a_mut, (colE1 ori, ampR, BsaI site removed through mutagenesis)
-
Selectable markersKan
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMedium Copy
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameKuste3340
-
Alt nameACP
-
Insert Size (bp)252
- Promoter op5_BsaI_3340_for
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ccacctgaattcatgagatctggatcggtctcaatgcatgataccattcaaaaactgaaagaactgc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameKuste3350
-
Alt nameACP
-
Insert Size (bp)201
- Promoter op5_3350_for
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer caaataaaggaggttttctaatgcgtgatatgtactacctgaaaa
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPJ169(JPUB_006769) was a gift from Harry Beller (Addgene plasmid # 83835 ; http://n2t.net/addgene:83835 ; RRID:Addgene_83835) -
For your References section:
Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli. Javidpour P, Deutsch S, Mutalik VK, Hillson NJ, Petzold CJ, Keasling JD, Beller HR. PLoS One. 2016 Mar 14;11(3):e0151087. doi: 10.1371/journal.pone.0151087. eCollection 2016. PONE-D-16-02052 [pii] PubMed 26975050