-
Purposeshuttle plasmid for sarA P1-mCherry expression
-
Depositing Lab
-
Depositing OrganizationUniversity Medical Centre Utrecht
Located in the Netherlands -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84455 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 84455-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 84455-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCM29
- Backbone size w/o insert (bp) 6604
- Total vector size (bp) 6574
-
Modifications to backbonesGFP replaced with insert
-
Vector typeshuttle vector E.coli-S.aureus, expression of sGFP from the SarA-P1 promoter
-
Selectable markersalso contains Chloramphenicol resistance gene, but only functional in Gram-postive bacteria.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)E.coli DC10b (described in doi: 10.1128/mBio.00537-12)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
Insert Size (bp)739
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site xmai (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TTGCATGCCTGCAGGTCGACTCTA
- 3′ sequencing primer TTATGCTTCCGGCTCGTATGTTGTGTGG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made bymCherry amplified from pJL49 ; Liese J, Rooijakkers SHM, van Strijp JAG, Novick RP, Dustin ML. 2013. Intravital two-photon microscopy of host–pathogen interactions in a mouse model of Staphylococcus aureus skin abscess formation. Cellular microbiology 15:891.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 84455-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 84455-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRN11 was a gift from Reindert Nijland (Addgene plasmid # 84455 ; http://n2t.net/addgene:84455 ; RRID:Addgene_84455) -
For your References section:
Fluorescent reporters for markerless genomic integration in Staphylococcus aureus. de Jong NW, van der Horst T, van Strijp JA, Nijland R. Sci Rep. 2017 Mar 7;7:43889. doi: 10.1038/srep43889. 10.1038/srep43889 PubMed 28266573