pBbA5k-Maqu_0582
(Plasmid
#86200)
-
PurposeExpresses efflux pump in E. coli to provide resistance to biofuel (medium copy)
-
Depositing Lab
-
Depositing OrganizationUniversity of Vermont and State Agricultural College
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86200 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBbA5k
- Total vector size (bp) 9496
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEfflux pump
-
Insert Size (bp)5853
- Promoter ATCGTTTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAAT
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGATCCAAACTCGAGTAAGG
- 3′ sequencing primer GATCTTTTAAGAAGGAGATATACAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid carries D1044N in Maqu_0582 and M1I in Maqu_0583 compared to the genomic reference sequence. These mutations do not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbA5k-Maqu_0582 was a gift from Mary Dunlop (Addgene plasmid # 86200 ; http://n2t.net/addgene:86200 ; RRID:Addgene_86200) -
For your References section:
Trade-Offs in Improving Biofuel Tolerance Using Combinations of Efflux Pumps. Turner WJ, Dunlop MJ. ACS Synth Biol. 2015 Oct 16;4(10):1056-63. doi: 10.1021/sb500307w. Epub 2014 Dec 12. 10.1021/sb500307w PubMed 25496359