pHT-PRD
(Plasmid
#87755)
-
PurposeBacterial expression vector for producing 6x histidine tagged dynamin 1a proline rich domain (residues 746-864)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87755 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepND1 with modified restriction sites
-
Backbone manufacturersee Biochim Biophy Acta. 1990; 1050(1–3): 18–26.
- Backbone size w/o insert (bp) 2217
- Total vector size (bp) 2602
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSemi-synthetic gene coding for dynamin 1a proline rich domain (residues 746-864)
-
SpeciesSynthetic
-
Insert Size (bp)385
-
GenBank IDP21575
- Promoter T7 RNA polymerase promoter
-
Tag
/ Fusion Protein
- 6X histidine tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Cla I (not destroyed)
- 3′ cloning site Xho I (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGGA
- 3′ sequencing primer AATTAACCCTCACTAAAGGGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Requires strains with T7 RNA polymerase (e.g. BL21) for expression
Addgene NGS results found F862L substitution within the dynamin 1a proline rich domain translation compared to reference sequence P21575.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHT-PRD was a gift from Yu-Wen Hwang (Addgene plasmid # 87755 ; http://n2t.net/addgene:87755 ; RRID:Addgene_87755)