pBJ 2358
(Plasmid
#89245)
-
PurposeExpresses YFP fused to the N-terminus of Mouse Capping Protein Alpha1, using the Clontech vector PEYFP C-1.
-
Depositing Lab
-
Depositing OrganizationWashington University in Saint Louis
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 89245-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 89245-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEYFP C-1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 7700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCapza1
-
Alt nameMouse Capping Protein Alpha1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3000
-
GenBank IDNM_009797.2
-
Entrez GeneCapza1 (a.k.a. CAPZ, CAZ1, Cappa1, capZ alpha-1)
- Promoter CMV
-
Tag
/ Fusion Protein
- YFP (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 89245-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 89245-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBJ 2358 was a gift from John Cooper (Addgene plasmid # 89245 ; http://n2t.net/addgene:89245 ; RRID:Addgene_89245) -
For your References section:
CPI motif interaction is necessary for capping protein function in cells. Edwards M, McConnell P, Schafer DA, Cooper JA. Nat Commun. 2015 Sep 28;6:8415. doi: 10.1038/ncomms9415. 10.1038/ncomms9415 PubMed 26412145
