Skip to main content
Addgene
Open Menu

pCMV-DeAct-GS1
(Plasmid #89445)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89445 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 89445-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 89445-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4746
  • Total vector size (bp) 5118
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DeAct-GS1
  • Alt name
    Gelsolin segment 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    372
  • Mutation
    Truncation spanning cytoplasmic Gsn amino acids 53-176
  • GenBank ID
    NM_000177.4
  • Entrez Gene
    GSN (a.k.a. ADF, AGEL)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer ATGTGGTATGGCTGATTATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-DeAct-GS1 was a gift from Brad Zuchero (Addgene plasmid # 89445 ; http://n2t.net/addgene:89445 ; RRID:Addgene_89445)

  • For your References section:

    DeActs: genetically encoded tools for perturbing the actin cytoskeleton in single cells. Harterink M, da Silva ME, Will L, Turan J, Ibrahim A, Lang AE, van Battum EY, Pasterkamp RJ, Kapitein LC, Kudryashov D, Barres BA, Hoogenraad CC, Zuchero JB. Nat Methods. 2017 Apr 10. doi: 10.1038/nmeth.4257. 10.1038/nmeth.4257 PubMed 28394337
Related items:
Commonly requested with: