pMSCV-IRES-EYFPBsd
(Plasmid #89544)

• Purpose: (Empty Backbone) Retroviral expression vector. Contain cloning site (EcoRI/XhoI) followed by IRES and EYFPBsd fusion
• Depositing Lab: Alf Grandien
• Depositing Organization: Karolinska Institutet
  Located in Sweden
• Publication: Grandien lab plasmids (unpublished)

Backbone

• Vector backbone: MSCV
• Vector type: Retroviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: None

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

EGFP and EYFP were amplified from MSCV-IRES-EGFP or MSCV-IRES-EYFP with junction markers for Zeo and Bsd in 3' (forward primer EGFP-upper; AATACCATGGTGAGCAAGGG and reverse primer EGFPZeo-lower; GGCACTGGTCAACTTGGCGTCCATGCCGAGAGTGATC for EGFPZeo and reverse primer EGFPBsd-lower; GAGACAAAGGCTTGGCCTGGTCCATGCCGAGAGTGATC for EYFPBsd). Zeo and Bsd containing junction markers in 5' were amplified by PCR from pTracer-SV40 (Invitrogen) and pLenti6/UbC/V5-DEST (Invitrogen) respectively (forward primer EGFPZeo-upper ; GATCACTCTCGGCATGGACGCCAAGTTGACCAGTGCC and reverse primer Zeo-NotI-lower ATAAGCGGCCGCTCAGTCCTGCTCCTCGG for Zeo and forward primer EGFPBsd-upper; GATCACTCTCGGCATGGACCAGGCCAAGCCTTTGTCTC and reverse primer Bsd-lower AATTGCGGCCGCTTAGCCCTCCCACACATAACC for Bsd). Then, EGFP and Zeo or Bsd, EYFP and Zeo or Bsd, were mixed together in a PCR reaction, first without primers, in order to hybridize the two fragments, then together with primers (forward primer EGFP-NcoI-upper; AATACCATGGTGAGCAAGGG and reverse primer Zeo-NotI-lower; ATAAGCGGCCGCTCAGTCCTGCTCCTCGG for EGFPZeo and EYFPZeo, forward primer EGFP-NcoI-upper; AATACCATGGTGAGCAAGGG and reverse primer Bsd-NotI-lower; AATTGCGGCCGCTTAGCCCTCCCACACATAACC for EGFPBsd and EYFPBsd). The four different fusions were inserted into pMSCV-IRES-GFP, previously cleaved with NotI and NcoI to remove EGFP.