Skip to main content

pTH861-gst-optec P210T
(Plasmid #89595)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89595 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5240
  • Total vector size (bp) 5935
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    glutathione-S transferase P210T mutant, codon-optimised for bacterial expression
  • Species
    synthetic construct
  • Insert Size (bp)
    695
  • Mutation
    changed proline 210 to threonine
  • GenBank ID
    LT799420.1
  • Promoter T7
  • Tag / Fusion Protein
    • 8xhistidine (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GGCGCCAGCAACCGCACCTGTGGC
  • 3′ sequencing primer GCGCCGCTACAGGGCGCGTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTH861-gst-optec P210T was a gift from Tobias von der Haar (Addgene plasmid # 89595 ; http://n2t.net/addgene:89595 ; RRID:Addgene_89595)
  • For your References section:

    Codon-Dependent Translational Accuracy Controls Protein Quality in Escherichia coli but not in Saccharomyces cerevisiae. Jossé L, Sampson CDD, Tuite MF, Howland K, von der Haar T. bioRxiv 200006 10.1101/200006