Skip to main content

pMRXIP Lamp1-Venus
(Plasmid #89937)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89937 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pMRXIP Venus-N
  • Backbone manufacturer
    Dr.Shoji Yamaoka of Tokyo Medical and Dental University
  • Backbone size w/o insert (bp) 6832
  • Total vector size (bp) 8053
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rat Lamp1
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1221
  • GenBank ID
    NM_012857.2
  • Entrez Gene
    Lamp1 (a.k.a. LGP120)
  • Tag / Fusion Protein
    • Venus (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer gacgGAATTCatGCCATGGCGGCCCC
  • 3′ sequencing primer GATGGTCTGATAGCCCGCGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    It has the pMX backbone

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRXIP Lamp1-Venus was a gift from Noboru Mizushima (Addgene plasmid # 89937 ; http://n2t.net/addgene:89937 ; RRID:Addgene_89937)
  • For your References section:

    The ATG conjugation systems are important for degradation of the inner autophagosomal membrane. Tsuboyama K, Koyama-Honda I, Sakamaki Y, Koike M, Morishita H, Mizushima N. Science. 2016 Nov 25;354(6315):1036-1041. Epub 2016 Oct 20. 10.1126/science.aaf6136 PubMed 27885029