NGN3-T2A-NLS-tdTomato-ires-puro-BGHpA-PGK-puro
(Plasmid
#89994)
-
PurposeDonor template for generation of NGN3-ntdTomato reporter cell lines
-
Depositing Lab
-
Depositing OrganizationUniversity of Helsinki
Located in Finland -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89994 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 89994-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 89994-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 9769
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNGN3-T2A-NLS-TdTomato-ires-puro-BGHpA-PGK-puro
-
SpeciesH. sapiens (human)
-
Entrez GeneNEUROG3 (a.k.a. Atoh5, Math4B, NGN-3, bHLHa7, ngn3)
- Promoter none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer M13-rv caggaaacagctatgaccatg
- 3′ sequencing primer M13-fwd tgtaaaacgacggccagt
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made bytdTomato sequence was cloned from pCSCMV:tdTomato (a gift from Gerhart Ryffel, Addgene plasmid #30530)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 89994-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 89994-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NGN3-T2A-NLS-tdTomato-ires-puro-BGHpA-PGK-puro was a gift from Timo Otonkoski (Addgene plasmid # 89994 ; http://n2t.net/addgene:89994 ; RRID:Addgene_89994)