Skip to main content

LP539
(Plasmid #90203)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90203 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 90203-D50 50 μg of DNA in Tris buffer $495
DNA 90203-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV-Myc
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 5900
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TRAPPC8
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2100
  • Mutation
    aa residues 1-700
  • GenBank ID
    NP_055754.2
  • Entrez Gene
    TRAPPC8 (a.k.a. GSG1, HsT2706, KIAA1012, TRS85)
  • Promoter CMV
  • Tag / Fusion Protein
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer M13 Reverse: CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Figures in Verdier et al. 2016 might suggest Myc tag is at the C-terminus, but the cloning vector is pCMV-Myc and the Myc tag is placed on N-terminus of protein.
Addgene's sequencing results found an S697D mutation in TRAPPC8 compared to the reference sequence NP_055754.2. This mutation is not known to affect plasmid function.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LP539 was a gift from Lotte Pedersen (Addgene plasmid # 90203 ; http://n2t.net/addgene:90203 ; RRID:Addgene_90203)
  • For your References section:

    Targeting of ASH Domain-Containing Proteins to the Centrosome. Verdier P, Morthorst SK, Pedersen LB. Methods Mol Biol. 2016;1454:15-33. doi: 10.1007/978-1-4939-3789-9_2. 10.1007/978-1-4939-3789-9_2 PubMed 27514913