Skip to main content

pL452-Sf3b1-K700E
(Plasmid #90425)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90425 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pL452
  • Backbone size w/o insert (bp) 4823
  • Vector type
    homology-directed repair vector
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sf3b1 - left and right homology arms
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    800
  • Entrez Gene
    Sf3b1 (a.k.a. 155kDa, 2810001M05Rik, Prp10, SAP155, SF3b155, TA-8, Targ4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal1 (left arm); BamH1 (right arm) (not destroyed)
  • 3′ cloning site EcoR1 (left arm); Not1 (right arm) (not destroyed)
  • 5′ sequencing primer TCACTAAAGGGAACAAAAGC (left arm); TCGACTAGAGCTTGCGGA (right arm)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL452-Sf3b1-K700E was a gift from Alex Minella (Addgene plasmid # 90425 ; http://n2t.net/addgene:90425 ; RRID:Addgene_90425)
  • For your References section:

    Degenerate minigene library analysis enables identification of altered branch point utilization by mutant splicing factor 3B1 (SF3B1). Gupta AK, Murthy T, Paul KV, Ramirez O, Fisher JB, Rao S, Rosenberg AB, Seelig G, Minella AC, Pillai MM. Nucleic Acids Res. 2018 Nov 20. pii: 5193340. doi: 10.1093/nar/gky1161. 10.1093/nar/gky1161 PubMed 30462273