pL452-Sf3b1-K700E
(Plasmid
#90425)
-
Purposeselectable HDR vector to introduce K700E mutation within mus Sf3b1 gene (for use with sgSf3b1(T1) and pL452(hygro)-Sf3b1-K700K plasmids enabling generation of hemizygous K700E mutation)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90425 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepL452
- Backbone size w/o insert (bp) 4823
-
Vector typehomology-directed repair vector
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSf3b1 - left and right homology arms
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)800
-
Entrez GeneSf3b1 (a.k.a. 155kDa, 2810001M05Rik, Prp10, SAP155, SF3b155, TA-8, Targ4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sal1 (left arm); BamH1 (right arm) (not destroyed)
- 3′ cloning site EcoR1 (left arm); Not1 (right arm) (not destroyed)
- 5′ sequencing primer TCACTAAAGGGAACAAAAGC (left arm); TCGACTAGAGCTTGCGGA (right arm)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL452-Sf3b1-K700E was a gift from Alex Minella (Addgene plasmid # 90425 ; http://n2t.net/addgene:90425 ; RRID:Addgene_90425) -
For your References section:
Degenerate minigene library analysis enables identification of altered branch point utilization by mutant splicing factor 3B1 (SF3B1). Gupta AK, Murthy T, Paul KV, Ramirez O, Fisher JB, Rao S, Rosenberg AB, Seelig G, Minella AC, Pillai MM. Nucleic Acids Res. 2018 Nov 20. pii: 5193340. doi: 10.1093/nar/gky1161. 10.1093/nar/gky1161 PubMed 30462273