pRSF_6His-ZmSUMO1a-GG_ZmSCE1b(C94S)-Myc
(Plasmid
#91933)
-
PurposeBacterial expression of maize SUMO1a and inactive SCE1b
-
Depositing Lab
-
Depositing OrganizationWashington University in Saint Louis
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91933 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRSFDuet-1
- Backbone size w/o insert (bp) 3829
- Total vector size (bp) 4625
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert name6His-ZmSUMO1a-GG
-
SpeciesZea mays
-
Insert Size (bp)283
-
MutationTruncation of ZmSUMO1a after the diGlycine motif
-
Tag
/ Fusion Protein
- 6His (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer GGATCTCGACGCTCTCCCT
- 3′ sequencing primer GATTATGCGGCCGTGTACAA;
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameZmSCE1b(C94S)-Myc
-
SpeciesZea mays
-
Insert Size (bp)513
-
MutationC94S active site mutation
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TGTACACGGCCGCATAATC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSF_6His-ZmSUMO1a-GG_ZmSCE1b(C94S)-Myc was a gift from Richard Vierstra (Addgene plasmid # 91933 ; http://n2t.net/addgene:91933 ; RRID:Addgene_91933) -
For your References section:
Defining the SUMO System in Maize: SUMOylation Is Up-Regulated during Endosperm Development and Rapidly Induced by Stress. Augustine RC, York SL, Rytz TC, Vierstra RD. Plant Physiol. 2016 Jul;171(3):2191-210. doi: 10.1104/pp.16.00353. Epub 2016 May 15. 10.1104/pp.16.00353 PubMed 27208252