pX330.sgNf1.4
(Plasmid
#92028)
-
PurposepX330 sgNf1.4 for Nf1 deletion
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in the United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92028 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 92028-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 92028-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepx330
-
Vector typeMammalian Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgNf1.4
-
gRNA/shRNA sequenceGATTATCCGAATTCTTAGCA
-
SpeciesM. musculus (mouse)
-
GenBank IDNC_000077
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 92028-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 92028-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330.sgNf1.4 was a gift from Wen Xue (Addgene plasmid # 92028 ; http://n2t.net/addgene:92028 ; RRID:Addgene_92028) -
For your References section:
Genome-Wide CRISPR Screen Identifies Regulators of Mitogen-Activated Protein Kinase as Suppressors of Liver Tumors in Mice. Song CQ, Li Y, Mou H, Moore J, Park A, Pomyen Y, Hough S, Kennedy Z, Fischer A, Yin H, Anderson DG, Conte D Jr, Zender L, Wang XW, Thorgeirsson S, Weng Z, Xue W. Gastroenterology. 2017 Apr;152(5):1161-1173.e1. doi: 10.1053/j.gastro.2016.12.002. Epub 2016 Dec 10. 10.1053/j.gastro.2016.12.002 PubMed 27956228