Skip to main content

PhOTO-M (pMTB:memb-Dendra2-2A-H2B-Cerulean)
(Plasmid #92401)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92401 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 92401-D50 50 μg of DNA in Tris buffer $495
DNA 92401-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pMTB
  • Backbone size w/o insert (bp) 6362
  • Total vector size (bp) 8381
  • Vector type
    Zebrafish Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Dendra2
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • GenBank ID
    GU734658.1
  • Promoter bactin2
  • Tag / Fusion Protein
    • membrane tag (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer SP6 - atttaggtgacactatagaagag
  • 3′ sequencing primer ccttagtcaccgccttcttg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Cerulean
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • GenBank ID
    KP666136.1
  • Promoter bactin2
  • Tag / Fusion Protein
    • H2B tag (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer CGAAgagggcagaggaagtc
  • 3′ sequencing primer TATAGTGAGTCGTATTAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PhOTO-M (pMTB:memb-Dendra2-2A-H2B-Cerulean) was a gift from Periklis Pantazis (Addgene plasmid # 92401 ; http://n2t.net/addgene:92401 ; RRID:Addgene_92401)
  • For your References section:

    PhOTO zebrafish: a transgenic resource for in vivo lineage tracing during development and regeneration. Dempsey WP, Fraser SE, Pantazis P. PLoS One. 2012;7(3):e32888. doi: 10.1371/journal.pone.0032888. Epub 2012 Mar 14. 10.1371/journal.pone.0032888 PubMed 22431986