Skip to main content
Addgene
Open Menu

pBa-LSS-GFP-LDLR wt
(Plasmid #98184)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98184 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 98184-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 98184-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pBa-eGFP
  • Backbone size w/o insert (bp) 6755
  • Total vector size (bp) 9335
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LDLR
  • Alt name
    human low density lipoprotein receptor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3326
  • Mutation
    none
  • GenBank ID
    NM_000527
  • Entrez Gene
    LDLR (a.k.a. FH, FHC, FHCL1, LDLCQ2)
  • Promoter Chicken Beta Actin
  • Tags / Fusion Proteins
    • GFP (N terminal on insert)
    • LDLR signal sequence, N-term of GFP so GFP remains on mature protein when ss is cleaved (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII-vector, NheI-insert (destroyed during cloning)
  • 3′ cloning site RsrII (not destroyed)
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer GATGAGTTTGGACAAACCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBa-LSS-GFP-LDLR wt was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 98184 ; http://n2t.net/addgene:98184 ; RRID:Addgene_98184)

  • For your References section:

    A novel split kinesin assay identifies motor proteins that interact with distinct vesicle populations. Jenkins B, Decker H, Bentley M, Luisi J, Banker G. J Cell Biol. 2012 Aug 20;198(4):749-61. doi: 10.1083/jcb.201205070. 10.1083/jcb.201205070 PubMed 22908316
Related items:
Commonly requested with: