MAP1LC3A-V1
(Plasmid
#98569)
-
PurposeExpresses MAP1LC3A-V1
-
Depositing Lab
-
Depositing OrganizationChildren's Cancer Hospital Egypt 57357
Located in Egypt -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98569 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 98569-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 98569-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepIRES2-AcGFP
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 5966
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMAP1LC3A
-
Alt nameLC3A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)366
-
GenBank IDNM_032514
-
Entrez GeneMAP1LC3A (a.k.a. ATG8E, LC3, LC3A, MAP1ALC3, MAP1BLC3)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AAAAAGAATTCATGCCCTCAGACCGGCC
- 3′ sequencing primer AAAAAGGATCCTCAGAAGCCGAAGGTTTCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 98569-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 98569-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MAP1LC3A-V1 was a gift from Shahenda El-Naggar (Addgene plasmid # 98569 ; http://n2t.net/addgene:98569 ; RRID:Addgene_98569) -
For your References section:
LC3A Silencing Hinders Aggresome Vimentin Cage Clearance in Primary Choroid Plexus Carcinoma. Nassar M, Samaha H, Ghabriel M, Yehia M, Taha H, Salem S, Shaaban K, Omar M, Ahmed N, El-Naggar S. Sci Rep. 2017 Aug 14;7(1):8022. doi: 10.1038/s41598-017-07403-5. 10.1038/s41598-017-07403-5 [pii] PubMed 28808307