p-OiRS3GG
(Plasmid
#98589)
-
PurposeExpresses default target RNA (gI intron) and pheS cassette (in place of an antisense RNA probe, for golden gate cloning) in E. coli (kanR).
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98589 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCML193
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsEscherichia coli str. K-12 substr. MG1655 is recommended by the depositor for expression
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namegroup I intron
-
SpeciesTetrahymena
-
Insert Size (bp)393
- Promoter pBAD
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePheS cassette to be selectively replaced by unique asRNA probes
-
Insert Size (bp)1087
- Promoter pLtetO
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsmbI (not destroyed)
- 3′ cloning site BsmbI (not destroyed)
- 5′ sequencing primer CGAGTCCCTATCAGTGATAGAGATTGACATCCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Russel, UT Austin (group I intron)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p-OiRS3GG was a gift from Lydia Contreras (Addgene plasmid # 98589 ; http://n2t.net/addgene:98589 ; RRID:Addgene_98589) -
For your References section:
Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions. Vazquez-Anderson J, Mihailovic MK, Baldridge KC, Reyes KG, Haning K, Cho SH, Amador P, Powell WB, Contreras LM. Nucleic Acids Res. 2017 May 19;45(9):5523-5538. doi: 10.1093/nar/gkx115. 10.1093/nar/gkx115 PubMed 28334800